Your English writing platform
Discover LudwigExact(2)
"And I was doing something that they found even more unappealing: I was inserting myself into the case".
So when I sat down a couple of years ago and started writing a book of memoirs, I believed I was inserting myself in its history.
Similar(58)
This example reads naturally and flows for the reader, whereas if an "I" was inserted at the start, while not hugely different, it would read more like a list.
To this end a double PCR product digested with Mlu I and Xho I was inserted into the same sites of pcDNA.
To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.
But at least I feel like I am inserting myself in a productive way and making the whole thing a little less painful for my client.
Backstage at Hackney's festival Field Day, I am inserting contact lenses at a trestle table covered in weed and Rizlas while Steve "Oneman" Bishop is drinking Red Bull and talking to me about belt drives and 1210s.
I'm inserting an invented person into a known historical time – just as Golding did with Dean Jocelin in The Spire and as Andrew Miller has done recently with Baratte the engineer in his Costa Prize-winning Pure – and embarking on a timeless human drama, that of the individual struggling to understand his place in the world.
And I know many of you will think that I'm inserting race into something where it didn't exist, but that's the thing about modern-day racism, it's usually a psychological and subconscious perpetration of pejorative language and ideas -- but I digress.
For this, all combinations of occurring loads μ and MCS i are inserted into Eqs.
Assume that each vector tree T i is inserted with one encoded bit e i (e i = 0, 1).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com