i was inserted

USAGE SUMMARY

The phrase "I was inserted" is grammatically correct and can be used in written English.
It can be used in contexts where someone is discussing being placed or included in a situation, system, or narrative. Example: "During the experiment, I was inserted into the simulation to gather data on user interactions."

✓ Grammatically correct

Science

News & Media

Human-verified examples from authoritative sources

Exact Expressions

4 human-written examples

This example reads naturally and flows for the reader, whereas if an "I" was inserted at the start, while not hugely different, it would read more like a list.

The Guardian

To this end a double PCR product digested with Mlu I and Xho I was inserted into the same sites of pcDNA.

Plosone

To make the pIRES-DHFR vector system, the DHFR gene digested with Sal I and Not I was inserted into MCS-B site separated from MCS-A by an internal ribosome entry site (IRES) sequence (581 bp) in the pIRES vector (Fig. 1A).

Plosone

To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.

BMC Genomics

Human-verified similar examples from authoritative sources

Similar Expressions

56 human-written examples

For this, all combinations of occurring loads μ and MCS i are inserted into Eqs.

EURASIP Journal on Wireless Communications and Networking

Assume that each vector tree T i is inserted with one encoded bit e i (e i  = 0, 1).

EURASIP Journal on Advances in Signal Processing

The two Galileo copies: (i) are inserted in opposite orientation; (ii) present exchanged target site duplications; and (iii) are both chimeric.

Plosone

Then the occurrence i is inserted into the list L w ′.

Algorithms for Molecular Biology

Let Δ (i, r, s ) denote the difference in objective function value if request i is inserted at its best position into route r of solution s.

Computers and Operations Research

"And I was doing something that they found even more unappealing: I was inserting myself into the case".

The New Yorker

So when I sat down a couple of years ago and started writing a book of memoirs, I believed I was inserting myself in its history.

Huffington Post

Expert writing Tips

Best practice

Use "I was inserted" when you want to emphasize a passive role in being placed or included within a specific context. Consider whether a more active voice would be more appropriate and direct for your writing.

Common error

Avoid using "I was inserted" when an active voice would create a stronger, clearer sentence. For example, instead of "I was inserted into the program", consider "They inserted me into the program" or "I joined the program".

Linguistic Context

The phrase "I was inserted" functions as a statement describing a passive action, where the subject ('I') is the recipient of the action (being inserted). It indicates a placement or inclusion, as confirmed by Ludwig's examples.

Expression frequency: Uncommon

Frequent in

Science

61%

News & Media

33%

Formal & Business

6%

Less common in

Wiki

0%

Encyclopedias

0%

Reference

0%

Ludwig's WRAP-UP

The phrase "I was inserted" is a grammatically sound passive construction used to indicate placement or inclusion, often without direct control. While Ludwig AI confirms its correctness, the frequency is uncommon, appearing more often in scientific and news contexts. When writing, consider whether an active voice might be more direct and impactful. Alternatives like "I was included" or "I was placed" can offer subtle variations in meaning. The phrase is versatile enough for both formal and informal use, though clarity and strength should always guide your choice.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

I was included

Focuses on being part of a group or set, rather than a physical placement.

I was placed

Emphasizes a deliberate act of putting someone in a specific location or role.

I was integrated

Highlights the process of becoming part of a larger system or entity.

I was incorporated

Implies being formally added or made part of something.

I was positioned

Suggests a strategic placement, often for a specific purpose.

I was introduced

Focuses on being brought into a new environment or situation.

I was admitted

Emphasizes being allowed entry or acceptance into a group or place.

I was comprised

Indicates being made up as part of a larger whole.

I found myself

Highlights the act of discovering yourself in an environment.

I became part

Focuses on the process of joining or belonging to something.

FAQs

What does "I was inserted" mean?

The phrase "I was inserted" indicates that the speaker was placed or included into something, often without their direct control or initiation. It suggests a passive role in becoming part of a system, process, or narrative.

What can I say instead of "I was inserted"?

You can use alternatives like "I was included", "I was placed", or "I was integrated" depending on the specific context.

Is "I was inserted" formal or informal?

"I was inserted" is relatively neutral in tone and can be used in both formal and informal contexts. However, in very formal writing, consider whether a more precise and active verb might be preferable.

How can I use "I was inserted" in a sentence?

You can use "I was inserted" to describe being put into a situation, like, "During the experiment, I was inserted into the simulation". Or, you can use it when part of a narrative like, "I do not consider myself some kind of folk hero, nor do I enjoy being inserted into the narrative.