Sentence examples for i insertion into from inspiring English sources
PCR was performed with the Platinum Supermix (Invitrogen), following the manufacturer's instructions (Ta 55°C, 32 cycles) and with these primers for NdeI/XhoI insertion into pET28a: Forward: 5' GGGAATTCCATATGATGATGGTTACAGTTGTC AGCAATT 3'; Reverse: 5' CCGCTCGAGTTAACTCACTCTTTTGCCGGATGC 3'.
The catalytic core region of the G. zeae SENP8 homolog (protein sequence identifier GI: 46121295), spanning from residues 1-228, was cloned via PCR and EcoRI/SalI insertion into pET28a, using Platinum Supermix (Ta 65°C, 36 cycles) and these primers: Fwd.: 5' GGCCGGGAA TTCATGCCGTTTCGTCAGAGGATGG 3'; Rev.: 5' GGCCGGGTCGACTCAGCG TGTTTGGATCACCTTG 3'.
Other studies also support the umbrella-like model for domain I insertion into membranes [ 34, 40, 41].
The Vldlr construct was generated by MluI-SalI insertion of the cDNA insert into pENN AAV TBG PI construct.
Depending on which Mos1 insertion site was used, transgenes were cloned into pCFJ151 (ChrII insertion, ttTi5605; UniI insertion, oxTi185; UniIV insertion, oxTi177), pCFJ352 (ChrI insertion, ttTi4348), or were cloned de novo (assembly of multiple linear DNA fragments obtained by PCR [ Gibson et al., 2009]; ChrV insertion, ttTi22935).
i Insertion of mobile element.
We find that this step encounters a free-energy barrier of approximately 7 kcal/mol, whereas the analogous transition in pathway I (alkene insertion into the Rh H bond) is almost barrierless.
The constructs fell into two broad classes: i) large insertions into the split site (constructs 1 and 3) or, ii) circularly permuted (swapping of the N- and C-termini) with or without insertions (constructs 2 and 4).
In 1970 he produced two politically provocative projects called "Insertions Into Ideological Circuits".
To construct the GST-fusion protein expression vectors, the BTBD inserts from the prey vector pPC86 were amplified using primers complementary to the BTBD coding regions with additional Sma I and EcoR I restriction sites for insertion into these sites in pGEX-2TK (Pharmacia).
