Sentence examples for i eco from inspiring English sources

In the membrane structure μ the model implements five hierarchical EBs labeled as ECO, P i, RS i, H i and B i ECO is the skin EB representing the peripheral ecosystem or ultimate container for all populations and environments.

Genomic DNA was digested with the restriction enzymes EcoR I (Eco) and Mse I (Mse) (NEB, Ipswitch, MA, USA).

d: Sac I, Bgl II, Not I, Kpn I, Eco RV, Pst I, and Hind III sites are underlined.

Oligonucleotides AGCT GTCTAGCGATATCGGATCCG (forward) and AATT CGGATCCGATATCGCTAGCA (reverse) were annealed (protruding ends italicized) and the resulting double-strand oligonucleotide was ligated into the pSk1-GFP plasmid, resulting in the insertion of a poly-linker containing restriction sites Cla I, Hind III, Nhe I, Eco RV, Bam HI and Eco RI (Branche and Bastin; unpublished data).

One Eco R I selective primer: Eco R I-GC; Eight Mes I selective primers: Mes I-GT, GA, TC, TG, TT, TA, AC and AG).

Since then, readers have debated dilemmas such as "Is cargo ship travel sustainable?' and "Is eco travel a middle class sport?" and searched for information on eco friendly car hire and treehouses.

From one bulk ligation (300 ng of pExpress 1 vector, Not I- Eco RV cut, and 120 ng of Not I digested cDNA per 120 μl of ligation), followed by electroporation into T1 phage resistant E. coli, primary clones were produced.

Since the libraries were not normalized and to avoid redundancy of the ESTs, a large-insert library (average insert size 2.4 kb) and a small-insert library (average insert size 1.4 kb) were constructed in pExpress 1 (Not I- Eco RV cloned into T1 phage-resistant DH10B E. coli).

85 A useful marker to control for this is the co-migration of a size marker or, alternatively, comparison of the patterns in question with the results from an actual partial digest (fragments resulting from an incomplete Eco RI digest have around 6.5, 9, and 10 kb, and a 4.1-kb fragment appears also in Eag I- Eco RI incomplete digestion when using StB12.3 or equivalent probe).

Additional file 2: cDNA-AFLP profiles using one Eco R I selective primer and eight Mes I selective primers.

For me, once I discover one eco-solution, it always leads to something else.