Sentence examples for i am underlining from inspiring English sources

Exact(2)

When my character visits Fusun's middle class family for eight years looking at TV every night I am underlining, tongue in cheek, the actual experience of 90percentt of humanity.

When my character visits Fusun's middle-class family for eight years, looking at TV every night, I am underlining, tongue in cheek, the actual experience of 90percentt of humanity.

Similar(57)

And I'm underlining the if and when".

The White House had sent a copy of the president's remarks to reporters and I was underlining key parts of it as he spoke.

I was underlining like mad, dog earring pages left and right, and calling my husband every five seconds to read a passage.

Tandem versions were generated by digesting EcoRI/Xba and inserting an additional linker (AATTTTGTCTTCCTGATCGGCGCCGCAGGAATACTCTTCGTATCTAGAGTGAATTCCTAA, newly situated restriction sites Xba-EcoRI are underlined).

Linker constructs were obtained by excising the Epac1 ΔDEP, CD) domain using EcoRV/NheI and replacing it with a linker (GATATCCTTTTGCTAGC, restriction sites EcoRV-NheI are underlined), yielding a 13aa linker (SGLRSRYPFASEL) between the two fluorophores.

The Ala135 codon substituting the His codon of wild-type SP I is underlined.

FP1: 5′ - ATA T GG ATC CTA CAC AAT GTC TGC CGC ACC CAC CAC CAC CGT - 3′ (BamHI is underlined), RP1: 5′ - ATA T AA GCT TCT AGT TGG TGA CAA ATT TTC TGG GAG AA - 3′ (HindIII is underlined) and FP2: 5′-ATA T GG ATC CTA CAC AAT GTC TGC CAC ACC CAC CGC CGC CGT - 3′ (BamHI is underlined), RP2: 5′ - ATA T AA GCT TCT AGT TGG TGA CAA ATT TTC TGG GAG AGG - 3′ (HindIII is underlined).

And somehow, it's underlined.

"I think he's underlining the point that I've been making all along," Mr. Miller said.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: