Sentence examples for housekeeping house from inspiring English sources

Six Hearst magazines had ad-page increases in December, he said: Good Housekeeping, House Beautiful, Marie Claire, Country Living, Cosmopolitan and O, the Oprah Magazine.

As a contributor to The Mix at Hearst Digital Media, her articles have been featured in Cosmopolitan, Seventeen, Good Housekeeping, House Beautiful, Town & Country, Elle Decor, Country Living, Woman's Day, Redbook, and Esquire.

Articulating clear eligibility criteria and obtaining verifiable lists of names of persons expected at the POD (including relevant contractors such as housekeeping and house security) helped maintain order at the front door.

Hire a housekeeping or house-cleaning service so the person you are buying for can stop cleaning on a regular basis indefinitely or for an extended period of time.

They have lectures on quality control, the latest food and drink, front of house and housekeeping skills.

So they're putting their chef, they're putting their driver, they're putting their housekeeping in a separate house.

For normalization of human Klotho expression, HPRT was included as a housekeeping gene using in house developed primers (FW: GGCAGTATAATCCAAAGATGGTCAA; REV: GTCTGGCTTATATCCAACACTTCGT) and probe (CAAGCTTGCTGGTGAAAAGGACCCC) (Eurogentec Nederland B.V., Maastricht, The Netherlands).

For example, driving a truck, plumbing, roofing, house painting, housekeeping, and so forth.

The five magazines taking part in the home campaign will be Country Living; Good Housekeeping, with its Your Good House edition sent to higher-income subscribers; House Beautiful; O at Home; and Veranda.

For 66 isolation rooms that had not been cleaned by housekeeping (59 rooms that previously housed MRSA carriers and 7 that housed patients with C. difficile infection), 28 of 261 (10.7%) surfaces were positive for MRSA before disinfection at 22,000 μWs/cm, and only 2 of these sites (0.8%) remained positive after Tru-D disinfection (P < 0.001).

Broke and homeless, they've set up temporary housekeeping in an empty beach house.