Sentence examples for homogenized in two from inspiring English sources

After removal of the remaining interphase between the supernatant and the cells, blood pellets were homogenized in two volumes of RNA before storage at −80 °C.

Individuals or tissues were homogenized in two volumes of cold PBS (20 mM sodium phosphate and 130 mM NaCl, pH 7.2) plus protease inhibitor cocktail.

These scraping samples were homogenized in two volumes (w/v) of the 1.15 % ice-cold KCl solution, using a Heidolph 50110 R2R0 homogenizer (Schwabach, Germany).

Lungs were removed and homogenized in two volumes of buffer A (50 mmol/l Tris-HCl, pH 7.5, 1 mmol/l EDTA, 10% glycerol, 0.5 mmol/l DTT, 5 mmol/l MgCl2 and 1 mmol/l PMSF) containing protease inhibitor cocktails.

Primers used for PCR XIAP: Sense: 5'ggccagactatgcccattta3' Antisense: 5'cgaagaagcagttgggaaa3' β-Actin: Sense: 5'gtcgtaccactggcattgt3' Antisense: 5'cagctgtggtggtgaagct3' Single and co-cultures of glioma cells, siXIAP transfected cells or nude mice brain tissues were harvested and homogenized in four volumes of homogenization buffer as described previously [56].

Single and co-cultures of glioma cells or nude mice brain tissues were harvested and homogenized in four volumes of homogenization buffer (pH 7.4; 250 mM sucrose, 10 mM HEPES, 10 mM Tris-HCl, 10 mM KCl, 1% NP-40, 1 mM NaF, 1 mM Na3VO4, 1 mM EDTA, 1 mM DTT, 0.5 mM PMSF plus protease inhibitors: 1 µg/mL pepstatin, 10 µg/mL leupeptin and 10 µg/mL aprotinin) using a Teflon-fitted glass homogenizer.

Single and co-cultures of glioma cells or nude mice brain tissues were harvested and homogenized in four volumes of homogenization buffer and processed for cell lysates as described previously [ 27].

A piece of frozen liver was homogenized in nine volumes of 10% perchloric acid, and the homogenate was centrifuged at 15,000× g.

Brain samples (0.5 g each of either, cerebellum, occipital cortex, or thalamus) were homogenized in ten volumes of buffer containing 0.32 M sucrose, 20 mM HEPES homogenization buffer (pH 7.2), 1 mM DTT, 1 mM PMSF, and a complete protease inhibitor cocktail, using ten strokes of tight-fitting glass homogenizers.

Tissues were immediately homogenized in ten volumes of cold (4 °C) Tris HCl (10 mM, pH 7.4).

To prepare insoluble fractions, dissected tissue was sequentially homogenized in four buffers (3 mL/g wet weight of tissue) with glass dounce tissue grinders (Kimble, Vineland, NJ, USA): 1) high salt (HS) buffer: 50 mM Tris-HCl pH 7.5, 750 mM NaCl, 5 mM EDTA; 2) HSbuffer with 1%Triton X-100; 3) HSbuffer with 1%Triton X-100 and 1 M sucrose; and 4) phosphate-buffered saline (PBS).