Sentence examples for his using from inspiring English sources
The Δpxa1 strain was transformed with the pxa2::his using PEG-LiAc method (Gietz and Schiestl [2007]) to construct double deletion strain Δpxa1&2.Transformed deletion stains Δpxa1&2 strain were selected via histidin prototroph by growing on synthetic complete minimal medium deficient in histidine.
In August 2010, a total of 20 operations in Africa, Asia and Middle East and North Africa regions were reporting into the HIS using common tools and guidelines.
Palmeiro previously tested positive for using steroids; this was the first reference to his using amphetamines.
Some mocked President Bush, too, when he referred to his using "the Google" and "the Internets".
His using my identity made it look as if I was involved.
He went public that he was quitting andro because his using it might have a negative effect on young people.
In this work, a strategy was developed for the chiral detection of L-His using an organic electrochemical transistor (OECT) sensor based on molecularly imprinted polymer (MIP).
In the second step, the T7 promoter and omega sequence were fused to eYFP-His using primers 11 (5' end of T7 promoter), 12 (3' end of T7 promoter and omega sequence) and 10 as the previous step.
Plasmid pIVEX_GAA_Omega_eYFP-His was prepared by inserting annealed oligonucleotides 1 and 2 (Additional file 2) containing the T7 promoter and the TMV 5' leader sequence (omega) into pIVEX1.3_eYFP-His using the NspI and NcoI sites.
Plasmid pIVEX_GAA_E02_eYFP-His was prepared by inserting annealed oligonucleotides 3 and 4 (Additional file 2) containing the T7 promoter and the synthetic 5' UTR E02 into pIVEX1.3_eYFP-His using the NspI and NcoI sites.
FMR1 cDNA was then amplified from the total cDNA of S2-cells using the forward (catgggtacccaccatggaagatctcctcgtgga) and the reverse (catggaattcaaggacgtgc cattgaccag) primers and inserted in pMT-sfGFP-His using KpnI and EcoRI restriction sites.
