Sentence examples for highest diversity in from inspiring English sources

The genus Boechera contains an array of morphologically and ecologically diverse taxa with highest diversity in western North America.

Code.org's Code Studio will be training teachers in 60 different school districts in the U.S., including the 7 largest school districts with the highest diversity in the country.

Most notably, the latitudinal pattern of highest diversity in high northern latitudes (as observed for 16x intertidal assemblages) is not consistent with the postulated pattern of low latitudinal diversity peaks [11].

Following initial screening of primers to achieve the highest diversity in lengths for all the isolates, the primers used were: RACEK15'2 (5'AATGGCGGCGCGTAGGTAGACTCT3') for the 5'end, nested with NESTEDK15'2 (5'CCCGTTGGTCandGGAAGAAGGGT3') and RACE13'2 (5'TCGATGAGAGTCTACCTACGCGCC3') for the 3'end, nested with NESTED15'2 (5'ATTGCGCAATACATGGCCACGGTG3').

Exon 2 and the corresponding domain α1 had the highest diversity in both species, while exon 4 and domain α3 had the lowest.

DGGE analysis of the dsrB gene fragments showed the highest diversity in sediments of the anaerobic and facultative ponds (" Electronic supplementary material").

The highest diversities in DWV were observed around the initiation of translation, whereas IAPV had high values at the 5' and 3' extremes of the genome.

When ζ > 0, we obtain higher diversity in the locations of the AF sidelobes.

Conversely, waxy claystone and sandy waxy claystone samples show a higher diversity in the vegetation composition.

In other words, there is low diversity in the majority of nodes, but high diversity in a minority of nodes.

In contrast, high diversity in the C-terminus marks divergent within the pheromone-forming region (Fig. 1).