Sentence examples for higher order array from inspiring English sources

Once all are found for a certain higher order array of sizes M1, M2,..., M R, and for a certain Pfa, then the model order can be estimated by applying the following cost function.

Tensors are higher order arrays that generalize the concepts of vectors (first-order tensors) and matrices (second-order tensors), whose elements are indexed by more than two indices.

Microtubules are dynamic polymers that often function as higher order arrays of different geometries that form in response to cell cycle and environmental cues.

In humans [ 35] and in Arabidopsis [ 36] centromeric repeats have been shown to consist of higher order arrays, composed of closely related yet divergent nucleosomal repeat monomers.

In humans, centromeres are defined by AT-rich repeats called α satellites, which are based on a 171 bp monomer that is tandemly arranged into higher order arrays that extend from 0.2 to 5 Mb.

To extract structured information from this high-volume dataset, we deconvolved the 3D tensor into multiple components by performing parallel factor analysis (PARAFAC), a generalization of principal component analysis (PCA) to higher order arrays (Harshman and Lundy, 1994) and measured the consistency of deconvolution under different iterations of PARAFAC (Bro and Kiers, 2003).

In this paper, a high order array (tensor) is suggested for data representation, based on which the Uncorrelated Multilinear Principal Component Analysis (UMPCA) is applied to analyze the variation of human motion patterns.

In this context, it is notable that our initial characterization of DMA1 and DMA2 satellite sequences provides evidence for higher-order arrays in the Aye-Aye genome with monomer sequence relationships that appear to have greater intrachromosomal similarity compared with interchromosomal relationships (figs. 6 and 7).

Instead, the telomere sequence consists of TTAGG repeat arrays (Robertson and Gordon 2006) interspersed with TCAGGCTGGG, TCAGGCTGGGTTGGG, and TCAGGCTGGGTGAGGATGGG higher order repeat arrays (Garavís M, Villasante A, unpublished results) (fig. 3).

Higher order (HO) arrays, commonly called tensors, play an important role in numerous applications, such as chemometrics [1], telecommunications [2], and biomedical signal processing [3].

It is tempting to speculate that the appearance of those higher order repeat arrays with propensity to form 3-quartet G-quadruplexes caused the decay, and eventual loss, of the telomeric retrotransposons.