Sentence examples for higher level expression in from inspiring English sources

An NK cell signature (G12 gene cluster including Fc gamma receptors and DAP-12) has previously been reported in one study with higher level expression in primary GBM with shorter survival compared to low grade astrocytomas and secondary GBM [ 10].

We therefore over-expressed active Caspase-9 (high level expression) in combination with the inactive proforms of Caspase-3 or -7 (expressed at low levels) (Figures 2G, 2H, S5).

A synthetic gene encoding CtxB was designed for high level expression in plant cells and cloned as ubiquitin (Ub) fusion in a plant expression vector.

To this end, a synthetic gene, encoding a mature wheat nsLTP1 polypeptide, was designed to ensure high level expression in Escherichia coli.

Efforts aimed at recombinant expression of functional striated muscle myosin isoforms in bacterial or insect cell culture have largely met with failure, although high level expression in muscle cell culture has recently been achieved at significant expense.

These results underscore the idea that potential 5′ mRNA secondary structures should be considered along with codon usage when designing a synthetic gene for high level expression in E. coli.

A very simple cis-regulatory motif associated with high level expression in photoreceptors was found.

We thus needed a more comprehensive approach to identify the bottlenecks for high level expression in GCDM.

The PA-mediated pathway also appears to influence the high level expression in 293T as seen by the significant reduction in GFP but not β-gal expression by n-butanol (Figure 4A and 4B).

To enable high level expression in Escherichia coli, pduS was amplified by PCR using pAR3114 as a template and 5'-CGCCATATGAAGACAGCTATGACGGCAG-3' as the forward primer and 3'CGCACTAGTTAACCTCTTATTACCGTGATGGATTGC 5' as the reverse primer.

These findings suggest that synergistic activation of photoreceptor gene transcription by Crx and Nrl as first reported for Rho-CRE [26], is a common principle of photoreceptor CRE design, at least for CREs which drive high level expression in rods.