Sentence examples for having restriction from inspiring English sources

Exact(5)

According to the amino acid sequence which was reported in a previous paper (Liu et al. 2013; Li et al. 2013), primers having restriction sites for NdeI (GGAATTCCATATGGCTGGTACCCTTGCGAG) and EcoRI (CGGAATTCTTACTAGTGCTTCAGGGTGAGA) were used for gene amplification.

A genomic DNA fragment that covers from − 1930 to + 30 nucleotides of the translation start site of OsINV3 was amplified by PCR with primers PINV3-L2H and -R2X, having restriction sites HindIII and XbaI, respectively, at the 5'end of each primer (Additional file 1: Table S1).

Briefly, gene specific forward (5′AGTCGGATCCATGGCCGAAGCAAAGAATCG-3′) and reverse (5′ATGCCTCGAGGGCTTCATTACCAATGGC3′) primers having restriction sites for the enzymes BamHI (F) and XhoI (R) were synthesised.

Vectors were constructed using the primers having restriction sites as follows: Antibodies against M1 (Sc-69824, Sc-17589) and cyt c (Sc-13560) were obtained from Santa Cruz Biotechnology Santaa Cruz, CA, USA).

AFP promoter +25 – luciferase (AFPPr + 25 – luc): AFP promoter region encompassing –230 to +25 base pairs (bp) was PCR amplified using genomic DNA from HepG2 cells with primers having restriction sites MluI and NheI at 5′ and 3′ ends respectively.

Similar(54)

We have restrictions for our costumes".

Qatar has restrictions on foreign buyers.

Mr. Hinckley will have restrictions.

We do have some specific entry requirements for programmes, but we don't have restrictions.

"Can you imagine if we had restrictions of speech, or the surveillance state, 400 years ago?

Up until then, it had restrictions on what players wore, but not on coaches".

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: