Overall, we had a sequence for both genes for 67 specimens and 59 species of Astrophorida.
At that point I had not had a sequence of games long enough for people to see what I was all about.
Zebrafish also have a sequenced genome, allowing for easy gene finding and straightforward comparison of zebrafish genes to human genes [ 30- 33].
Apparently the star activity of DraIII has a sequence preference for the central three nucleotides, whereas the canonical cleavage activity does not (Grosskopf et al., 1985).
Within the context of CATNNNGTG, the DraIII star activity has a sequence preference for the central three nucleotides, whereas the canonical cleavage activity does not (Grosskopf et al., 1985).
We have established a sequence for the mango transcriptome from a pool of tissues.
In the few cases where an STU does not have a barcode sequence for the same population for which sexual system data is derived (L.
We did not examine miR-133b because it was considered to function similarly to miR-133a; these microRNAs have very similar sequences (miR-133a: UUGGUCCCCUUCAACCAGCUGU, miR-133b: UUGGUCCCCUUCAACCAGCUA) and have a common sequence for binding to FSCN1 mRNA (UUGGUC).
Coughlin said the Giants have a coordinated sequence for making such determinations.
Since Runx2 does not have a consensus sequence for Akt phosphorylation, Akt is not likely to phosphorylate Runx2 directly, but may regulate the activity or stability of co-activators or co-repressors of Runx2.
