Sentence examples for gus at the from inspiring English sources

However, the transgenic rice plants carrying 35S promoter::GUS at the same stage showed GUS activity not only in vascular tissue but also the other tissues (data not shown).

My husband was astounded by the sheer volume of complaints from Gus at the beginning of the hike.

Therefore, GUs at the 4th, 8th and 12th years from the beginning of the simulation are 41, 60 and 71%%, respectively, which are all high values.

Labour leader Ed Miliband said he had worked with Sir Gus at the Treasury and the Cabinet Office: "He was an outstanding public servant, unfailingly helpful, thoughtful and supportive in implementing the agenda of the government.

This would explain the low level of specialization among GUs at the plant level and the mixed roles played by flowering GUs in M. spinosum.

In adult plants of this species, each GU extended in a particular growing season develops between one and three lateral and/or terminal GUs in the following growing season (Damascos et al. 2008), so that the total number of GUs at the surface of a plant tends to increase exponentially from one year to the next.

Primers carrying two copies of the 30-bp ATAF2 binding sequence and a XbaI restriction site (5′ AGCTTG TCTAGAGATCAGAAGAGCAATCAAATTAAAACACATATTAGGATCAGAAGAGCAATCAAATTAAAACACATATTAG G−3′ and 5′ TCGACCTAATATGTGTTTTAATTTGATTGCTCTTCTGATCCTAATATGTGTTTTAATTTGATTGCTCTTCTGATC TCTAGAC A−3′) were then introduced into pBI/35Sm-GUS at the HindIII and SalI sites (underlined) to create pBI/2X30bp-GUS.

Interestingly, the DR5::GUS seedlings treated with pseudomonad strains and HCN revealed a complete suppression of DR5::GUS expression at the root tip level.

However interestingly, we consistently observed GUS activity at the distal tip of cotyledons and leaves in 10 day old MSP1-GUS seedlings (Fig. 3V).

"His lucky day," Gus exclaims at the ceremony.

Sunderland have made steady progress with Gus Poyet at the helm this season, but having so far failed to steer themselves convincingly clear of the drop zone, a victory tonight could inject his side with further confidence.