Sentence examples for guidelines technical from inspiring English sources
In Carotid Artery Stenting: The Basics, Jacqueline Saw and a panel of international experts on carotid artery stenting discuss in depth the details of all contemporary aspects of carotid stenting, while reviewing supporting studies, guidelines, technical perspectives, and peri-procedural management.
In the regulatory context, a typical expression of this responsibilisation approach is self-regulation and its instruments, such as codes of conduct, guidelines, technical standards, reporting, audit, and so on (see Dorbeck-Jung and Shelley-Egan 2013, Arnaldi, Gorgoni and Pariotti 2016, Arnaldi 2014).
ShRNA oligonucleotides against human PTEN were designed according to Ambion guidelines (technical bulletin #506) using the siRNA sequences gctaagtgaagatgacaatca (#1), gcacaagaggccctagatttc (#2), gccagctaaaggtgaagatat (#3) with ttcaagaga as the loop sequence.
Output included methods, guidelines, technical support, information systems and publications.
Each centre is responsible for preventing and controlling disease, health education and promotion, the application of research results and guidelines, technical management and the services within its district [ 31].
As a guideline, Technical Report allow up to 30 references, but this can be flexible at the editor's discretion.
The bill includes funding via competitive grants for regional centers that would help relieve this burden by providing best-practice guidelines and technical assistance.
Springer's guidelines and technical instructions for the preparation of your contribution to a proceedings volume.
Below you will find Springer's guidelines and technical instructions for the preparation of proceedings papers.
Instead, with Google's guidelines and technical framework, the company is trying to create "paths of least resistance".
All the cases that are shown in this pictorial review comply with the European Society of Urogenital Radiology (ESUR) guidelines for technical mpMRI requirements.
