Sentence examples for gsp 1 from inspiring English sources

Exact(1)

Using nomenclature consistent with that study, we employed the following primers: GSP 1, ACCCTTCTTCTAACGGC; GSP2, TTTCGTGCGGCAAACGAAGTC; and GSP3, TGAATTCATCTCAAATCTCG.

Similar(59)

The buccal face of the tooth is markedly slanted unlike in TF 6223, Sivapithecus sivalensis (GSP 9564, GSP 15000, GSP 16082), Lufengpithecus lufengensis (PA 548, PA 848, PA 580, PA 895) and L. keyuanensis (pl. 1 in [31]).

With its chunky build, super comfortable cups and noise-cancelling tech, the Sennheiser GSP 600 headset (£220) is also gaining traction in the pro scene.

Abstract: Classical modular forms are very special automorphic functions for the group GL(2), and similarly holomorphic Siegel modular forms are very special automorphic functions for the group GSp(2n).

In this study, male Wistar rats were treated with Cd as cadmium chloride (CdCl2, 5 mg/ kg bw, PO) and pre-administered with GSP (100 mg/kg bw, PO) 90 min before the Cd intoxication for 4 weeks.

Local Newforms for GSp(4) describes a theory of new- and oldforms for representations of GSp(4) over a non-archimedean local field.

An appendix includes extensive tables about the results and the representation theory of GSp(4).

Fig. 5 Comparison of an orangutan (left) and a cast of Sivapithecus indicus (GSP 15000).

punctulata (GSP) 7.96 Gentian dried root 1 (DR1) 24.25 Gentian dried root 2 (DR28.05.05 aDry weight basis.

We analyzed different algorithms for sequence mining, such as AprioriSOME and AprioriAll [36], GSP [37], WAP [41], and PLWAP [42].

Among the numerous SPM techniques (see the survey proposed in [3]), we choose one of the simplest and most well-known, the Generalized Sequential Pattern (GSP) [4, 5].

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: