Sentence examples for grown on vector from inspiring English sources
(d) Wild-type animals (black bars) overexpressing the flp-7 transgene (OX; grey bars) grown on vector or atgl-1 RNAi containing bacteria were fixed and stained with oil Red O. Data are expressed as a percentage of body fat in wild-type (non-transgenic) animals±s.e.m. (lower panels; n=11 21).
inx-6 mutants grown on vector RNAi plates rarely developed to adulthood after temperature up-shift at either 16 or 24 hr.
Distal tip cell (DTC) hyper-proliferation was assessed on the basis of gonad arm bifurcations in kuEx119 -minus (GFP–) young adult progeny of lin-35 ; fzr-1 ; kuEx119 mutants grown on either vector-control or suppressor RNAi feeding plates.
Briefly, worms grown on OP50 bacteria, vector or RNAi of interest were washed off the plates with M9 buffer.
To determine whether BRMS1 protein is capable of auto-activation, yeast cells were co-transformed with the bait protein along with an AD empty vector, grown on selective medium (SD-T-L-H) and further assayed for β-Gal expression.
Approximately 50 synchronized L1 worms were grown on RNAi or empty vector control food in blinded 24-well plates as described (Hanover et al. 2005) from L1 to young adult (48 hr at room temperature) before being stained with iodine.
The qPCR primers were as follows: p62-1, CAGAGAATACCTTTGCCTCCCA; p62-2, AATCTTGGAGCTCCCCATGTC; parkin-1, ATTCAGAAGCAGCCAGAGGTC; parkin-2, CTGGCACTCACCACTCATCC. SH-SY5Y cells transfected with parkin-Myc or Myc-vector grown on coverslips were washed with phosphate-buffered saline (PBS) and fixed in 4% formaldehyde in DMEM for 30 min at 37°C.
Subsequently, the E. coli NK3 strain was transformed with the expression vectors harbouring the cDNAs and the empty vector and grown on minimal medium M9 with and without cysteine.
A single colony of GS115-SAM2/control GS115-SAM2/controlwith vector alone, GS115 on YPD agar platransformedculated in 5.0 ml of YPD medium and growitht 30°C, 280 rpm for ovectorht, aloneas used as inoculum.
The E. coli cells harboring the expression vector were grown on LB agar plates containing 50 μg/mL ampicillin and 34 μg/mL chloramphenicol.
