Sentence examples for genomics DNA from inspiring English sources
Libraries of fragmented genomics DNA were sequenced on 454-Genome Sequencer, FLX instrument at Interdisciplinary Center for Biotechnology Research ICBRR) at UF. De novo assemblies were constructed using 454 Newbler Assembler [ 27].
The business plans, technologies, size and financial health of these firms differed widely, but they shared a common reliance on methods and technologies associated with the then-new field of genomics: DNA sequencing, DNA manipulation on the chromosome or whole-genome scale, and bioinformatics.
For this, genomic DNA was isolated from the anticoagulated venous blood samples using the Wizard Genomics DNA Purification kit (Promega, UK), according to the manufacturer's instructions.
It also supports 59 social impact startups and non-profits, and has graduated companies like Getaround's car sharing service, Made In Space's 3D printers, and Cambrian Genomics' DNA laser printer.
Driven by the needs of functional genomics, DNA engineering by homologous recombination in Escherichia coli has emerged as a major addition to existing technologies.
With proper modifications of the protocols, it has been demonstrated that both genomics DNA and viral RNA could be extracted successfully in these microfluidic chips.
The best represented subject areas were population genetics (35.3% of the studies) and phylogeography (30.3%), while emergent fields in molecular ecology, such as landscape genomics, DNA-based trophic ecology, and kinship, parentage and behavior were scarcely represented.
Genomics DNAs were extracted from domesticated and wild silkworms, and stored in Tris-EDTA (TE) buffer at 4°C.
From the retrieved two DNA sequences, a new primer set (F: AAGTATTAGATCGTTACGGCGATGGAC, R: CCAAGAACACCAATCGTGTTATCAAGG) was designed and once again sent to Eurofins Genomics together with genomic DNA.
Total genomic DNA was isolated using the AVE Gene Plant Genomics DNA Mini Kit (AVE Gene, Korea), according to the manufacturer's protocol.
The JGI supports programs (http://bit.ly/Science-JGI) in plant, fungal, and microbial genomics, metagenomics, DNA synthesis, metabolomics and genomic technologies.
