Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
Genomic typing using chromosomal CGH enabled the identification of distinct profiles.
Similar(57)
One possible approach to partially level out chip-type specific differences is the matching of the probe sets of different array types using genomic sequence information updated with respect to the original probe set assignment of the manufacturer.
To analyze the methylation status of the promoter-associated CpG islands, we screened 15 human cancer cell lines from breast HCC-11433, MDA-MB-468, MDA-MB-468-PT, MDA-MB-468LN, MCF7, SK-BR-3, T47D, Hs578T, UACC3199, MDA-MB-231 and MDA-MB-436) and ovarian (SK-OV-3, IGR-OV1, OVCAR-3 and OVCAR-5) tumor types, using bisulfite genomic sequencing, methylation-specific PCR and pyrosequencing.
Genomic analysis of E. coli sequence types using the Comprehensive Antibiotic Database (CARD: http://arpcard.mcmaster.ca ).mcmaster.ca
To carry out genomic typing, DNA was extracted using the QIAamp DNA blood mini kit (QIAGEN GmbH, Hilden, Germany), according to the manufacturer's instruction.
Genomic typing was performed by using PCR with sequence-specific primers specific for HLA class II molecules [ 43, 44].
As a validation for the proposed integrative approach, we first compare the overall prediction accuracy of the integrative approach with those from each single genomic type based approaches using CNA, methylation, miRNA data separately.
Drosophila SAF-B was amplified from wild-type genomic DNA using Polymerase Chain Reaction with primers 1 and 6 (sequences below).
Probes for the locus were isolated by PCR from wild-type genomic DNA using the folloing primers using standard conditions (5' probe: TGGAGTAGGCAATACCCAGG and CACAGCCTCTTCTTTAGGCG, 3' probe: GGCACTGTTCATTTGTGGTG and GTGCCTGTGGAGGCTAGAAG) For reverse-transcriptase PCR (RT-PCR), total RNA was isolated from ES cell cultures using Qiagen RNeasy Mini Kit according to the manufacturer's instructions.
The first fragment was amplified from wild-type genomic DNA using the Expand High Fidelity PCR kit (Roche) using the primers JK76 (5'-ggg ggg gta cct gag gaa tgg gta ctt ccc aat ta-3') and JK75 (5'-gaa gga ctc cgg ggg cat ata ag-3').
CSC-containing DNA fragments were cloned from wild-type genomic DNA using standard PCR methods.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com