Sentence examples for genes we constructed from inspiring English sources

Using these genes, we constructed a classifier for bacterial LRTI with 90%7979% CV) sensitivity and 83% (76% CV) specificity.

To verify that the phenotypes of these strains were not due to a polar effect on the expression of neighboring genes, we constructed a markerless pmp23 deletion strain of S. pneumoniae R6 (Δpmp23).

To identify and analyze the expression patterns of these genes, we constructed a zebrafish cDNA microarray containing 4512 unique genes identified from zebrafish embryonic heart, adult hearts, and skeletal muscle cDNA libraries.

To build heterogeneous networks of diseases and genes, we constructed two kinds of networks: (1) gene/protein network, which connects genes/proteins by functional interactions; (2) disease similarity network, where a link between two diseases is specified by their similarity.

To confirm that miR172 controls flowering time via the AP2 genes, we constructed the miR172-resistant form of SNB (rSNB) by changing the miR172 target site CTGCAGCATCATCAGGATTCT to CTGCAGCAATGTCCGGATTCT (Figure 6A).

Using this list of homologous genes, we constructed a seed development network in Arabidopsis by processing the gene list and the rice network through a Perl utility software called Pathway GeneSWAPPER developed by us.

To understand better the liver-specific interactions among the expressed genes we construct the GWAS-based subnetwork of macular degeneration genes (Fig. 7B).

Given a list of genes, we construct a graph containing the genes in each information space; then the graphs were kernel transformed so they could be integrated; finally functionally coherent subsets were identified using a spectral clustering algorithm.

In order to identify modules of co-expressed genes, we construct the topological overlap-based dissimilarity [ 45, 46], which is then used as input to average linkage hierarchical clustering.

To determine the expression pattern of the ttr-11 gene, we constructed a transgene Pttr-11::nls::venus, which expresses the fluorescent protein VENUS fused to a nuclear localization signal (NLS) under the control of the ttr-11 promoter.

For the cloning of the Pi2-2 gene, we constructed a genomic BAC library of Jefferson with an average insert size of 140 kb.