Sentence examples for genes and targeting from inspiring English sources

Now, the news: Researchers at Yale and Carnegie Mellon universities have published a paper in Nature Communications revealing a completely different method of editing genes and targeting mutations that cause diseases.

Specific identification of CSC maintenance genes and targeting can improve the efficiency of currently available treatment modalities.

Expression changes in these genes need to be studied with specific experimental design, taking into account e.g. the daily cycles in the expression level of the genes and targeting the studies on specific tissues like the heads of the flies.

This is because the LTα gene is closely linked to the TNFα and LTβ genes and targeting the LTα gene can lead to collateral damage to the neighboring genes [ 24].

Here, we examine the Wnt pathway genes and target genes present in the genome of the echinoderm Strongylocentrotus purpuratus.

Thus, it predicted that host genes and target genes are interconnected between themselves.

Listed are all the genes and target sequences included in the probeset.

In addition, we will discuss some of the newly identified target genes and target pathways of PML RAR α.

Primer characteristics and qPCR performance data for the reference genes and target genes have been published recently [ 9].

GAPDH was used as the reference gene and targeted GAP-DH sense (5' CATCCACTGG TGCTGCCAAG 3') and antisense (5' GAGGGAGATGCTCAGTGTTGG 3') primers.

The presence versus absence of transcription regulatory (TR) genes and target genes (TG) dictate which connections are even possible.