Sentence examples for generation for screening from inspiring English sources

Exact(1)

F1 offspring were intercrossed and the G2 offspring were backcrossed to G1 parents to generate the G3 generation for screening.

Similar(59)

The generality of the syntheses reported by us and others represents a powerful starting point for generation of libraries for screening against a plethora of α-helix mediated PPIs.

In addition, by exploiting a FACs-based assay for the detection of the VLP fluorescence we here originally describe, 18-4s cells would be of a great utility for screening new generations of antiviral compounds targeting late events of HIV-1 replication.

Rock Eval pyrolysis is the most widely used method for screening the petroleum generation potential and thermal maturity of organic rich rocks.

Thus, this approach may be more useful for screening analyses or generation of large recombinant virus libraries in different poxviruses, including ECTV.

We used the multiple generation approach for screening, 13 as depicted in Figure 1 a, where the lead materials evolve from first identification of homopolymers to co-polymerization and finally lead composition optimization.

Successful germline integration of the plasmid was detected in the following generation by screening for white + flies.

We began by investigating the ionic conductances necessary for SNA generation by screening effects of ion channel blockers on network activity monitored via whole-cell current clamp [ 5, 6].

Modern enzyme development relies to an increasing extent on strategies based on diversity generation followed by screening for variants with optimised properties.

Subsequent transgenic generations were bred to background with WT C57BL/6 mice for 7 generations, whereby each generation was screened for transgenic positive offsprings by PCR.

Litters from F2-F12 generation were screened for HLA-DR4/I-Edαβ transgenes by PCR using specific primers for HLA-DR4α (forward, AATCCTGACCAATCAGGCGAG, reverse, GCGGAAGAGGTGATCGTCCCT) and HLA-DR4β (forward, GTTTCTTGGAGCAGGTTAAAC; reverse, CTGCACTGTGAAGCTCTCAC) transgenes.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: