Sentence examples for generating a human from inspiring English sources
To diminish the risk of generating a human anti-mouse antibody response in patients, chimeric variants were created.
The firm plans to acquire 20 of the new million-dollar sequencing machines from Illumina, which, when running at full capacity, should bring the cost of generating a human genome down to $1000.
The sub-cellular localization of PMLIb was verified by generating a human PMLIb /pcDNA 3.1 Hygro construct which was used to transfect murine PML +/+ and PML −/− fibroblasts.
The large proportion of NeuAcα2-6 may exert selective pressure for selection of influenza variants with altered receptor preference for this human-type α2-6 receptor, a crucial first step for generating a human pandemic.
After evaluation of several important and valuable opportunities, the idea of generating a human proteome network emerged as the most compelling opportunity.
Full-length 427-kd human Dystrophin (huDys) was produced by generating a human Dystrophin cDNA using long-range PCR (primers F1: SpeI_GACTAGTGTGTTCTTCATATGTATATCCTTCC; R1: MluI_CGACGCGTCATTGTGTCCTCTCTCATTG), digested with SpeI and MluI and cloned into pCI plasmid (Promega, Madison, WI, United States) downstream of a CMV promoter at the NheI and MluI restriction sites.
After a knock-out mouse lacking the gene known as Msx1 was generated, a human family was found who lacked one of their two copies of the gene.
British regulators on Wednesday issued the country's first license to use cloning techniques to generate a human embryo to produce stem cells that might be used for the treatment of disease.
We generated a human monoclonal antibody (mAb), designated 2A5, which targets the HCV envelope.
