Sentence examples for generated verified from inspiring English sources

One example is illustrated to show how all k-out-of-n MCs are generated, verified, and implemented to evaluate the k-out-of-n network reliability using the proposed algorithm.

Homology models of human TPO including the wild-type and two mutant proteins (p.Asp224del and p.Arg396Cys) were generated, verified and compared as described previously.

Transgenic strains overexpressing the genes encoding the P. anserina homologs of glyoxalase I (PaGlo1) and /or glyoxalase II (PaGlo2) and a PaGlo1 deletion mutant (Δ PaGlo1) were generated, verified and characterized.

For control purposes, a scrambled sequence was generated and verified (scrRNA 5-3′CUCGACAUAACACUGGUGCUU).

The e-coins are only generated and verified by the broker.

One example is illustrated to show how all MCs are generated and verified in a network using the proposed algorithm.

Design alternatives for products and processes matching a priori defined targets can be generated and verified through the PPD-lab.

Two examples are illustrated to show how all k-out-of-n MCs are generated and verified in a k-out-of-n network using the proposed algorithm.

One example is illustrated to show how all k-out-of-n MPs are generated and verified in a k-out-of-n flow network using the proposed algorithm.

All promoter sequences generated were verified by dideoxy sequencing.

The human PeriA vector was generated and verified as previously described [13], and various amounts of the vector was transfected to investigate relationships between expressional levels of PeriA and FSP27, and size of lipid droplets [28].