Sentence examples for generated to include a from inspiring English sources

A gBlock fragment (IDT, Coralville, IA) containing approximately 1 kb of the C-terminal portion of Myosin 10/11/14/9 (Kh. C11.456; [ Satou et al., 2005]) cDNA was generated to include a myc tag (GCATCAATGCAGAAGCTGATCTCAGAGGAGGACCTG) inserted immediately 5′ of the stop codon.

The only match was at Thr1410 and a peptide generated to include this site was phosphorylated by LRRK2, indicating its relevance (Figure 5A).

The substrate was generated by modifying pUC19 to include a region of PML intron 6 that contains an established breakpoint associated with therapy-related acute promyelocytic leukemia.

Positive sampling effects are generated by the increasing chance to include a highly productive species that dominates the community at higher diversity.

The proteins that were most frequently used in rules generated by BioHEL were found to include a number of relevant proteins including matrix metalloproteinase 3, interleukin 8 and matrix gla protein.

In 1997, the "Special Edition" re-releases restored and altered the original scene to include a computer generated portrayal of Jabba.

Other efforts to generate growth include a reduction in corporate tax in 2015 to 20 percent from 21 percent, a reduction in payroll taxes to help small and midsize businesses, and higher tax-free allowances for earners.

However, VAAST requires the user to generate and include a feature file, which contains the explicit boundaries for binning.

Their names, automatically generated, include a reference to the algorithms and the evaluation criterion used (e. g. a typical name would be "Filename_partitionH_SCluster_Upgma.txt").

Use a keyword suggestion tool to generate keywords to include in your article.

The covariance matrix is first generated without including a new station (to be referred to as the baseline case and as C 0), and the result is then compared with that generated by adding one of the virtual stations to the existing ground network (to be referred as C i for the i-th virtual station).