Sentence examples for generated to include from inspiring English sources
The combined image was 640×480 pixels and generated to include the wide-angle camera image scaled down by 0.25.
The only match was at Thr1410 and a peptide generated to include this site was phosphorylated by LRRK2, indicating its relevance (Figure 5A).
The personalized emails were automatically generated to include the title and the personal NCT number of the trial.
For increased alignment accuracy, the STAR genome index was generated to include splice junction annotations with the options '—sjdbGTFfile Homo_sapiens.GRCh37.70.primary_assembly.gtf —sjdbOverhang 49'.
Its design is also easily generated to include more lung units and bellows for greater resolution and more in-depth study.
A gBlock fragment (IDT, Coralville, IA) containing approximately 1 kb of the C-terminal portion of Myosin 10/11/14/9 (Kh. C11.456; [ Satou et al., 2005]) cDNA was generated to include a myc tag (GCATCAATGCAGAAGCTGATCTCAGAGGAGGACCTG) inserted immediately 5′ of the stop codon.
The last two digits from each telephone number were substituted with randomly generated digits, to include numbers that were not publicly available.
Scalar fields were then generated to describe growth, including magnitude and directional morphological changes.
Initially, we limited scope to data generated to 12 species including: human, mouse, rat, Arabidopsis, budding yeast, fission yeast, Drosophila melanogaster, Caenorhabditis elegans and zebra fish.
Use a keyword suggestion tool to generate keywords to include in your article.
WASHINGTON, D.C. The long list of hypotheses generated to explain why people stutter includes some whoppers.
