Sentence examples for generated to enable from inspiring English sources

For example, proteins with unique chemical handles for precise conjugation can be generated to enable next generation antibody-drug conjugate therapeutics.

The 3Ps Project then pools the intellectual property and scientific data generated to enable the collaborative research that will take these compounds from the bench to the bedside.

With practical GPS measurement from a selected test intersection, validation results of the vertical distance and lane curvature are analyzed, and virtual lanes are generated to enable continuous map matching in the intersection area.

As such, sufficient markers could only be generated to enable development of a genetic linkage map for the male parent.

Ideally, CBHI needs to be introduced alongside other initiatives to ensure effective use of funds generated to enable service quality improvements to members.

Charts documenting the averaged standardised copy numbers at each BAC location were generated to enable visual comparisons of genomic profiles between AC (23) and SCC (17) (figure 1).

Standard curves were generated using previously generated samples to enable normalization to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH; forward primer ACCCCTTCATTGACCTCAACTACATG; reverse primer CCTTCTCCATGGTGGTGAAGAC) using the Pfaffl method as described elsewhere [ 37].

The calculation is far higher – 50 percent higher for 2006 – when emissions generated elsewhere to enable British consumption are factored in.

We generated adenoviruses to enable expression of these mutant proteins in neonatal rat cardiomyocytes, which was confirmed by western blot.

The COUNTDOWN work in Cameroon will lead the way in bridging this gap, generating evidence to enable future research and policy agendas to prioritise assessment of NTD skin diseases appropriately.

This immune reaction after cell implantation possibly generates space to enable survival of implanted cells.