Your English writing platform
Discover LudwigExact(1)
Ced-10(n3246 pdr-1 lg103 pdr-1 lg103dites were crossed withermaphrodites already generated rescue strain pdr-1(lg103) ;byEx434[pBY1500], in wereh pBY1500 crosseds the complete operon of pdr-1 named K08E3 and sel-12::gfp has been used as a comarker.
Similar(59)
Alternatively, noncoding changes are often used to generate rescue constructs that are resistant to knockdown via RNAi.
(B ) Breeding scheme to generate rescue genotypes.
To generate rescue clones, females of the genotype FRT19A otd YH13 /FM7a; UAS-otd were crossed to males of the genotype FR19A,Tub-Gal80 FR19A,Tub-Gal80,hsFLPCD8::GFP/CyO.
To confirm the source of this epistasis, a transgenic approach was used to generate rescue strains with genomic insertions of the alternative OreR and Aut alleles of Aatm (Meiklejohn et al., 2013).
To generate rescue constructs of the endogenously expressed TBPH gene, we designed oligonucleotides complementary to regions (GAGCGTGGAACGTACAGTGA, GGTACCACATCATTGGGTGACA) flanking the 5′ and 3′ ends of the coding region, with an introduced KpnI site at the 5′ end of the C-terminal primer.
Similar results were obtained with another, independently generated dCREG rescue line.
We generated genomic rescue constructs for both HtrA2 and mRpL11 (gHtrandand gmRpL11, Figure 1a and methods).
Using genetic crosses, we generated a rescue genotype that encoded one copy of the recoded transgene (cytolocation 68A4) in a background of the Gal4 driver and UAS-driven HP1E hairpin.
To confirm that the impaired replication, despite of small entity (~1 log) but significant, observed for BoHV-4ΔIE1, was due to the loss of IE1 and not a mere artifact, BEK cells constitutively expressing IE1 were generated to rescue in trans the loss of IE1.
To determine the localization of MEG-3, we generated a rescuing GFP-tagged transgene and a polyclonal serum raised against a MEG-3 peptide ('Materials and methods' and Figure 5 figure supplement 1).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com