Sentence examples for generated from the templates from inspiring English sources

Exact(1)

Again, a set of input files for the simulations was generated from the templates, and the parameter sets were scored by running and analyzing the respective simulations.

Similar(59)

For instance, an infinite number of questions can be generated from the template "Solve for x: [num1]x + [num2] = [num3]." where [num1], [num2], and [num3] are variables in the template that should be assigned to numbers.

From this initial generation of parameter sets, a set of input files for the simulation engine was generated from the template input files.

After threading, full atomistic models of the Rev protein were generated from the template and alignment obtained from the threading studies using the MODELLER [29], [30], and NEST software tool incorporated in JACKAL 1.5 [49].

First, the starting structure (structure 6) is generated from the template nucleic acid in the starting material production step.

We then introduced the bar code into these vectors by digesting them with SacI and NheI endonucleases and ligating each to a SacI/NheI-digested PCR fragment that was generated from the template: Sig_T, 5′TAGTACGCGTGAGCTCTANNNNNNNNTACGTACGGCTAGCAAGCTCAATT3′, with the following primers: Sig_F, 5′AGCTGAAAGGATGACTAGTACGCGTGAGCTCT3′ and Sig_R, 5′CCCGACCTCGACCCGAATTGAGCTTGCTAGCC3′.

The high-resolution MP-RAGE was then segmented into cerebrospinal fluid and gray and white matter, with prior tissue probability maps for this step generated from the Template-O-Matic toolbox (http://dbm.neuro.uni-jena.de/software/tom/) (52), set for the age range of 8 11 years.

RNA Probe Synthesis: Digoxygenin-tagged RNA probes were generated from the DNA templates T3961 and MH_QR465, for Olig1 and Olig2 respectively.

In the first step copyDNA (cDNA) was generated from the RNA templates followed by transcription to copyRNA (cRNA) with incorporation of cyanine 3-CTP.

Three - layer MNI head model (MNI - 3 ): A three-layer, 12,498-node template BEM model representing brain, skull and scalp was generated from the MNI template head model.

Digoxigenin-UTP-labeled RNA probes were generated from the DNA template using a DIG RNA labeling kit (Roche).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: