Sentence examples for generated from the template from inspiring English sources

For instance, an infinite number of questions can be generated from the template "Solve for x: [num1]x + [num2] = [num3]." where [num1], [num2], and [num3] are variables in the template that should be assigned to numbers.

From this initial generation of parameter sets, a set of input files for the simulation engine was generated from the template input files.

After threading, full atomistic models of the Rev protein were generated from the template and alignment obtained from the threading studies using the MODELLER [29], [30], and NEST software tool incorporated in JACKAL 1.5 [49].

First, the starting structure (structure 6) is generated from the template nucleic acid in the starting material production step.

We then introduced the bar code into these vectors by digesting them with SacI and NheI endonucleases and ligating each to a SacI/NheI-digested PCR fragment that was generated from the template: Sig_T, 5′TAGTACGCGTGAGCTCTANNNNNNNNTACGTACGGCTAGCAAGCTCAATT3′, with the following primers: Sig_F, 5′AGCTGAAAGGATGACTAGTACGCGTGAGCTCT3′ and Sig_R, 5′CCCGACCTCGACCCGAATTGAGCTTGCTAGCC3′.

Again, a set of input files for the simulations was generated from the templates, and the parameter sets were scored by running and analyzing the respective simulations.

The high-resolution MP-RAGE was then segmented into cerebrospinal fluid and gray and white matter, with prior tissue probability maps for this step generated from the Template-O-Matic toolbox (http://dbm.neuro.uni-jena.de/software/tom/) (52), set for the age range of 8 11 years.

Three - layer MNI head model (MNI - 3 ): A three-layer, 12,498-node template BEM model representing brain, skull and scalp was generated from the MNI template head model.

Digoxigenin-UTP-labeled RNA probes were generated from the DNA template using a DIG RNA labeling kit (Roche).

The PCR products were at equimolar concentrations (26.1 ng each) with two exceptions; amplification products from the buffalo were added at double concentration (52.2 ng), and PCR products generated from the zebra template used twice the number of different tags.

Dig-labelled probes for sense and antisense Pomc mRNA were generated from the cDNA template corresponding to exon3 of Pomc in a pGem- T vector (Promega) and transcribed by SP6 or T7 RNA polymerase (Progema).