Exact(4)
Therefore, the nascent vector has the sub-cloned donor fragment positioned at the same expansion point at which PCR generated donor fragments would be inserted.
Digesting the PCR generated donor fragment with 'A' and 'b' enzymes, and ligating to the recipient vector opened up with 'a' and 'B' enzymes, creates a nascent vector where each of the original 'b', 'a', 'and and 'B' sites are destroyed.
Moving to more activated sulfonamides, two equivalents of the in situ generated donor gave high yields of deprotected products 14 (92 %) and 16 (90 %) from compounds 13 and 15, respectively.
For homologous recombination, we generated donor transgenes in which these exogenous sequences were flanked by two homology arms corresponding to the dsx locus: a 2.8-kb 5′ homology arm as per (Robinett et al., 2010) and a 2.7-kb 3′ homology arm extending between genomic sequences GCAATATTGGCACTCAGCTATTATC and CACGTTCGATATTGAGTTGGGTGAA in the dsx second intron.
Similar(56)
Due to the generated donors the p-type bulk will eventually be compensated to n-type bulk.
BM-derived MPCs (BM-MPCs) engrafted and generated donor-derived osteoblasts that improved the clinical signs associated with the disease and enhanced total body weight [ 6].
These data suggest that skin transplant is generating donor MHC II-specific T cell responses.
Whereafter, the as-synthesized ZnO NRAs were successfully doped with oxygen vacancies by sodium borohydride (NaBH4) solution reduction, aiming to generate donor energy levels below the conduction band.
Given that SCNT requires the use of assisted reproductive procedures to generate donor oocytes and to culture reconstructed zygotes to the point of transfer, it is important to establish whether similar comorbidities exist in apparently healthy aged cloned offspring, using a long-lived and precocial mammalian species.
Therefore, it was necessary to generate donor DNA carrying a different selectable marker.
Concerning tissue or cell transplants, basic problems are the isolation of adequate quantities of biological material and the necessity to generate donor defects in healthy cartilage.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com