To generate deleted mutants, PCR fragments cloned into pJQ200SK were inserted in C58 by electroporation.
2) Another possibility is that the inserted DNA may get deleted to generate ΔTI allele after two sequential events: a) PhiC31 mediated-insertion first followed by Cre mediated-recombination via JT15/JTZ17 (Additional file 1: Figure S3), and b) Cre mediated-insertion first via JT15/JTZ17 followed by PhiC31 mediated-recombination (Additional file 1: Figure S4A).
Meanwhile, a plasmid containing mutant IGF-1R 3′-UTR, nased as pGLO-IGF-1R-3'UTR-delete, was generated by deleting the core sequence of the two miRNA binding sites through DNA synthesis (Sangon Biotech (Shanghai) Co., Ltd ., the sequence is as follows: TCCTGGATCCCGATCCCGTGCAAACAGTACCGTGCGCACGCGGGCGGGCGGGGGGAGAGTTTTAACAATCTATTCACAAGCCTCCTGTACCC.
In this study, RNA editing could affect the alternative splicing pattern by another mechanism because no new splice sites were generated or deleted.
One possible explanation for the uniqueness of the ncRNAs identified here, may be that these ncRNAs are generated and deleted during genome reorganisations and gene reshuffling.
Preferential binding of Tel1p to short telomeres is also seen when short telomeres are generated by deleting YKu or by deleting a telomerase subunit (Hector et al. 2007).
The C-terminal deletion mutant was generated by deleting the 27 aa at the C-terminus.
Serial deletion mutants of CCN2 were generated by deleting the CT domain, CT and TSP-1 domains, and CT, TSP-1, and VWC domains; designated as CCN2/d3, CCN2/d2, or CCN2/d1, respectively.
Deletion constructs are as follow: pCMV-CL1-ΔHormR HA Flag was generated by deleting Phe479 Cys532.
To improve its efficacy, recombinant HearNPVs were generated by deleting the ecdysteroid UDP-glucosyltransferase (egt) gene (HaCXW1 and HaLM2) or by inserting the insect-specific toxin gene AaIT in the egt locus (HaCXW2) of HearNPV using conventional recombination strategies in insect cell culture.
