generate recognition

USAGE SUMMARY

The phrase "generate recognition" is correct and usable in written English.
It can be used in contexts where you want to express the act of creating awareness or acknowledgment of something, such as a brand, achievement, or idea. Example: "The marketing campaign aimed to generate recognition for the new product among potential customers."

✓ Grammatically correct

Science

News & Media

Human-verified examples from authoritative sources

Exact Expressions

6 human-written examples

The president of Malawi has accused Madonna of demanding VIP treatment, exaggerating her charity work and being "a musician who desperately thinks she must generate recognition by bullying state officials instead of playing decent music on the stage".

The Guardian

For her to accuse Mrs. Oponyo for indiscretions that have clearly arisen from her personal frustrations that her ego has not been massaged by the state is uncouth, and speaks volumes of a musician who desperately thinks she must generate recognition by bullying state officials instead of playing decent music on the stage.

The Guardian

Different liposome formulations were designed to act as carriers and to generate recognition by tumor epitopes.

Biochimica et Biophysica Acta (BBA) - Biomembranes

The paid for and free software model (one of the categories in Fig. 2) will have enterprise users to generate its revenue, and are able to offer reduced free versions to other users to generate recognition; providing the benefits and stability of proprietary software with a potential lack of cost.

Journal of Cheminformatics

Surveyors are all specially trained medical and nursing specialists, which results in a natural understanding of the daily challenges faced in the treatment of cancer patients; in this way the system is supposed to generate recognition and involvement of professionals.

British Journal of Cancer

The pattern formed by several dark recognition patches clearly coincide with the positions of the crystalline cellulose in the topography image; meanwhile, the molecule on the substrate which doesn't have specific interactions with the modified AFM tip will not generate recognition signal, i.e., the green marks shown in the topography image in Figure  1(c).

Biotechnology for Biofuels

Human-verified similar examples from authoritative sources

Similar Expressions

54 human-written examples

A clear correlation between the judgement of human experts and the automatically generated recognition rate is shown.

EURASIP Journal on Audio, Speech, and Music Processing

Mifune also states that Maeda was one of the most vigorous promoters of judo, although not by teaching the art, instead generating recognition of judo through his many combats with contenders from other disciplines.

Wikipedia

An immediate benefit of the bow-tie maze is its reliability in generating recognition discrimination scores (D1 and D2) that are significantly above chance with modest sized groups of animals [64]; see also [25].

Behavioural Brain Research

For SNP695871, Primer SCA2-AVAII (5'-ctcccggcggctccttggtctcggcggg CCTCCCCGCCCCTTCGTGGTC-3', mismatch underlined) was used such that one mismatch was introduced to generate a recognition site for the restriction endonuclease AvaII (recognition site 5'-G'G(A/T)CC-3').

Plosone

For SNP695872, Primer SCA2-NOTI (5'-ccttctccccctcgccagcccgggcgcccctccggccgcgccaacccgcg CCTCCCCGCTCGGCGGCCG-3', mismatch underlined) was used such that one mismatch was introduced to generate a recognition site for the restriction endonuclease NotI (recognition site 5'-GC'GGCCGC-3').

Plosone

Expert writing Tips

Best practice

Use "generate recognition" when you want to emphasize the creation of awareness or acknowledgement, especially for a new brand, idea, or achievement.

Common error

Avoid phrasing sentences in a passive voice when using "generate recognition". Instead of "Recognition was generated by the campaign", opt for the active form: "The campaign generated recognition."

Linguistic Context

The phrase "generate recognition" functions as a verb phrase where "generate" is the transitive verb and "recognition" is the direct object. It signifies the action of creating or producing acknowledgment or awareness. Ludwig confirms its correctness and usability in English.

Expression frequency: Rare

Frequent in

Science

33%

News & Media

33%

Wiki

33%

Less common in

Encyclopedias

0%

Formal & Business

0%

Reference

0%

Ludwig's WRAP-UP

The phrase "generate recognition" is a grammatically sound verb phrase used to describe the act of creating awareness or acknowledgment. While relatively rare in frequency, it is considered correct and appears in diverse sources, including scientific publications and news media, according to Ludwig. The phrase's primary function is to denote the active process of increasing visibility or acclaim for a product, idea, or brand. To broaden your writing, alternatives like "promote awareness" or "foster understanding" can be used, depending on the desired nuance. As Ludwig AI confirms, it is best used in the active voice to highlight the initiator of the recognition.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

promote awareness

Stresses the act of making something known more widely.

draw attention

Focuses on attracting notice, which is a prerequisite for recognition.

spur acknowledgement

Highlights the act of initiating or prompting recognition.

foster awareness

Focuses on nurturing and promoting understanding, rather than just creating recognition.

cultivate appreciation

Implies a gradual development of positive regard, going beyond mere acknowledgement.

elicit acclaim

Implies provoking public praise, a specific form of recognition.

encourage visibility

Emphasizes making something more noticeable, not necessarily recognized.

spark interest

Highlights creating curiosity as a first step towards recognition.

build reputation

Concentrates on establishing a positive standing over time, a longer process than generating recognition.

establish credibility

Centers on building trust and believability, essential for long-term recognition.

FAQs

How can I use "generate recognition" in a sentence?

You can use "generate recognition" to describe actions that lead to awareness or acknowledgment, such as "The company launched a marketing campaign to generate recognition for its new product."

What are some alternatives to "generate recognition"?

Some alternatives include "promote awareness", "foster understanding", or "build reputation", depending on the specific nuance you want to convey.

Is it better to say "generate recognition" or "create recognition"?

Both "generate recognition" and "create recognition" are acceptable, but "generate recognition" often implies a more active or dynamic process of bringing about awareness.

How does "generate recognition" differ from "gain recognition"?

"Generate recognition" suggests actively producing or initiating awareness, while "gain recognition" implies receiving or acquiring acknowledgement as a result of one's efforts.