Sentence examples for generate expression from inspiring English sources

Exact(60)

Amplified PCR fragments were cloned into pET151/D-TOPO to generate expression constructs that express a 6xHis-V5-TEV tagged fusion protein.

Overlapping PCR was used to generate expression cassette EC, which expresses the hbd, thl, crt, and bcd genes, and the Sol operon was amplified to express the adhE and ctfAB genes.

Generally sequences derived using these platforms can be processed to generate expression profiles of known genes and suitable computational methods can be employed to identify unknown genes.

To generate expression constructs, a second round of PCR was performed using primers flanked by adequate restriction sites and the pGEM-T clone as template.

Affymetrix® HG-U133A GeneChips were used to generate expression data for 22,000 probe sets identifying 18,400 transcripts of 14,500 genes.

To generate expression vectors for Flag-TRAM and Myc-MyD88, mouse TRAM and MyD88 cDNAs were cloned into pRK5 downstream of the Flag and Myc tags, respectively.

Thus we could easily generate expression vectors for all combinations of RC complexes and ATP synthase- with all fluorescent proteins (pSEMS-26 m vector derivatives).

NP, PA and PB2 were cloned into pcDNA3-FLAG, and PB1cFLAG was inserted into pcDNA3.1 (Invitrogen) to generate expression vector for C-terminal FLAG-tagged PB1.

A collaborative microarray project (based on Affymetrix ATH1 arrays), dubbed AtGenExpress, has utilized 79 different Arabidopsis samples in triplicate to generate expression data [29], [30].

To generate expression vectors containing genes for fibers with zippers incorporated into an extended H-I loop, we used previously designed fiber shuttle plasmid pHI-PB40 [13] as starting material.

The nucleotide sequence encoding myc epitope, GAACAAAAACTCATCTCAGAAGAGGATCTG, was introduced into human collectrin cDNA in frame distal to the signal sequence by PCR and then subcloned into pcDNA3.1 to generate expression vector pcDNA3.1-myc-collectrin.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: