Sentence examples similar to generate a folder from inspiring English sources

Similar(60)

You can also view the "csv" format results in the "reports" folder of pLink 2.   (26) To generate a concise summary of the disulfide-linked sites identified by pLink 2, copy the python script (attached to the end of this protocol) to your task folder, then open "Windows Explorer", type "cmd" in the location bar, and press "Enter" to open "Command Prompt".

DollyDrive will then generate a unique public link for the file or folder.

Printing from a folder view can be a good way to generate a report on multiple items because the user gets what is displayed on the screen.

Get a folder for each class, and label each folder.

Get a folder for homework.

WinFS stores are exposed as shell objects, akin to Virtual folders, which dynamically generates a list of all items present in the store and presents them in a folder view.

To prevent unauthorised access to shared data, the software generates a private key for each synched folder on the original device.

Google's addition of folders to Google Docs generated a great deal of conversation yesterday over the benefits of tags and folders.

To generate super folder GFP (sfGFP) tagged pMT-Sec24AB, pMT-Sec24AB LCS, and pMT-Sec24AB nonLCS, Sec24Ab LCS 1-4155 aa) were amplified from cDNA of Drosophila S2 cells using the forward (gatggaattccaccatgtcgacttacaat) and reverse (gtcagggccctctggagcagtggttc), and Sec24AB nonLCS (416 1184 aa) regions using forward (cagtgaattcatgctaaacgtggctca) and reverse (gtcagggccctctttttgcaacacatt) primers.

The newest versions of Chrome will also generate "Auto folders" which attempt to group bookmarks together based on context.

But that did not stop the computer repeatedly attempting to upgrade every time it turned on, generating error messages, and putting a folder that was between 3.5GB and 6GB big in a secret area on the computer.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: