Your English writing platform
Discover LudwigExact(54)
Two lists of dominant microbial genera were generated: a) top 20, the most abundant genera (based on 16S rRNA gene-based diversity surveys); and b) genomic information-rich genera (based on taxonomic affiliations of contigs) in SHP, according to relative abundance analyses.
Taxonomic revision of Myrmeciza (Aves: Passeriformes: Thamnophilidae) into 12 genera based on phylogenetic, morphological, behavioral, and ecological data.
Note: Myrica as treated in TJM (1993) split into 2 genera based on Wilbur 1994 Sida 16:93--107.
For the fungal composite phylogeny, we manually reconstructed the evolutionary relationships among different genera based on known or commonly accepted taxonomy using information from previously published reports.
The values of genera based on the log2 transformed relative abundance were performed using the Gene Cluster 3.0 software.
Isolated bacterial cultures (169 isolates) were grouped into different genera based on their short-length sequencing of 16S rDNA with 895F (CRCCTGGGGAGTRCRG), 47F (GCGCCAGGGAATTCTAAAAC) and 783R (ACCMGGGTATCTAATCCKG) primers.
Similar(6)
It is true that there is an existing agreement of classification to divide Ty1/Copia elements into several Pseudoviridae genera, but these genera are based on priming mechanisms instead of the phylogeny.
Treatments of the 15 eriogonoid genera are based on the monographic work of James L. Reveal, who is gratefully acknowledged.
Mercer and Roth calculated when various genera evolved, based on the number of changes in the DNA bases.
The following list of genera is based on the current published taxonomy.
Results: The potentially affected fraction of bacterial genera estimated based on antibiotic concentrations measured in water environments is ≤ 7%.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com