Sentence examples for gene tools from inspiring English sources

Morpholino antisense oligonucleotides (MOs) were obtained from Gene Tools, Inc.

The antisense morpholino oligonucleotides (MOs) were obtained from Gene Tools (Plilomath, OR).

The same amount of negative control morpholino (GENE TOOLS, LLC) was also injected as control.

The same amount of negative control morpholino (GENE TOOLS, LLC) was injected as control.

We purchased Morpholino antisense oligonucleotides from Gene Tools, Inc, (Philomath, OR).

Morpholino oligonucleotides were obtained from Gene Tools, LLC (Corvalis, OR).

The following morpholinos were used: NRAGE morpholino GGTTTCTGAGCCATAGCTCTCGTC (Gene-Tools), Tak1 morpholino AGCGCCCTTCAGCCCGGAGCCC (Gene-Tools), Tab1 morpholino CAGGCTCCTCCTCTGCGCCGCCATC (Gene-Tools), Control morpholino CCTCTTACCTCAGTTACAATTTATA (Gene-Tools).

Morpholino oligonucleotides (MOs) were synthesized by Gene-Tools, LLC (Corvallis, OR).

A SC MO (SC: CCTCTTACCTCAGTTACAATTTATA) (Gene-tools, LLC) was used in parallel, as a negative control.

MOs designed against X. tropicalis genes were supplied by Gene Tools.

Morpholinos were obtained from Gene Tools LLC.