Sentence examples for full lengths from inspiring English sources

Full lengths of straw might make the plastered wall a bit sturdier, but its stringy nature makes it difficult to trowel smooth.

The full lengths (~ 1500 bp) of 16S rRNA genes were obtained by PCR using universal bacterial primers (24F: AGAGTTTGATCCTGGCTCAG and 1492R: TACGGYTACCTTGTTACGACTT) (Farris and Olson 2007).

Now we have four releases, two full lengths and two EPs.

Watch previews for both new episodes above and catch the full lengths tonight on VICELAND.

The distance of the race was three and one half full lengths of the court (or 329 feet).

Prospectors staked claims and built cabins, and within a few years placer mining extended the full lengths of Cataract and Basin Creeks.

Diving full length on the ground!

WATCH: Islamic State - Full Length.

Watch the Full Length.

The Islamic State (full length).

Watch - Syria - Full Length.