Sentence examples similar to full length winter from inspiring English sources

An unfractured block was selected and a full length (1000 × 5 cm) core cut and trimmed.

Brisbane resident Scraps (AKA Laura Hill) released a debut full length last year that blew me away just by its title alone: Classic Shits 2006 200808.

The HIC-FL construct contained the full length 4607 nt HIC cDNA.

Here we present a strategy involving harmonization of codons for successful recombinant expression of full length Pfs48/45 in Escherichia coli.

This construct produced truncated RecB peptide (1 1062 amino acids long) lacking the C-terminal 165 amino acids from the nuclease domain of RecB (full length 1227 amino acids).

To gain insight into the putative function of XopD N-terminal extension, XopD amino acid sequence (full length XopD1-760) wanalyzedzed for its biochemical properties.

As depicted in figure 3C Sima-dependent induction of this reporter was observed, and induction levels were comparable to those of the full length [−1170 +1] original construct.

Dig-labeled sense and antisense probes were synthesized from a full length CG6860 cDNA, and used for in situ hybridization experiments following standard procedures.

The Full-Lengther software identified 28.6% of our transcripts as full length (8,818 transcripts), or putative full length (607 transcripts).

The following primer pairs were used: 5´ATGACCGTTGATATTATGCGTTTAC3´/5´TCAAGCCGAACCAAACACCAAAC3´ that amplify the full length 966-bp WRKY17 (At2g24570) cDNA, 5´ATGGAAGGAGGAGGAAGAGG3´/5´TCAGCCTCTCTTGGTGAAATCC3´ that amplify the full length 1,026-bp 1,026-bpA, and 5´ATGGCTGAGGCTGATGATATT3´/5´TTAGAAACATTTTCTGTGAACGATTCC3´ that amplify the full length 1,134 bp ACTIN2 (At3g18780) cDNA.

Briefly, four different PCR fragments were linked together to make full length 2500 bp mEZH2 promoter using overlap extension PCR.