Sentence examples for from using forward from inspiring English sources

Together, these bottlenecks discourage many from using forward genetics.

Partial 16S rRNA gene sequences obtained from clones using forward and reverse primers were assembled in a contiguous sequence using the phred/Phrap/CONSED program (Godon et al. 1997; Ewing et al. 1998).

In addition, a chloramphenicol antibiotic-resistance gene amplified from pKD3 using forward primer G72 (5'-AATATAGGATAACGAATCATGGCACAAGTATTAATACCAA CTGTandCTGGAGCTGCTTCG-3') and reverse primer G73 (5'-TTAATCAGGTTACAA CGATTAACCCTGCAGCAGAGACAGAACCATATGAATATCCTCCTTA-3') was introduced in the chromosomal fliC gene as previously described by Erdem et al [60].

In order to determine the genotype of each tree, a portion of the Lim1 gene was amplified from trees using forward (ACCAGTATGCCTTCATTGTGTTC) and reverse primers (AAAGACCAATGTCCCTAATAGTCATG).

To obtain the deletion construct pCL60-PGL341 56..134 308, a C-terminal fragment of PGL34 was amplified from pCL60-PGL34 using forward (5'-cat gcc atg gcc TTT GAG TGG TTT GGA GTC and-3') and reverse (5'-cat gcc atg gcA CTG TTG TAT TCA AGA TTC TCT ACA AC-3') primers including NcoI sites and ligated in the NcoI site of pCL60-PGL341 56. pCL60-PGL341 56

White blood cell populations were separated from cell fragments using forward and side scatter gating.

The SAA1 gene was amplified by PCR (Expand Long Template PCR System, Roche) from genomic DNA using forward (5'-tgacctgcagggactttccccagg-3') and reverse (5'-aactcatcatgtccttgcctcagg-3') primers.

The 681 bp of DsRed complete cDNA (AY569780.1) was amplified with PCR from pBac[3×P3−DsRedaf] [36] using forward primer AGGCCTCTAGAATGGTGCGCTCCTCCAAGAACGTCAT and reverse primer GTCCATCTAGACTACAGGAACAGGTGGTGGCGGCCCT, where the underlined sequences contain the XbaI recognition sequence (TCTAGA) and an additional randomly picked first five bases that work as a landing site for XbaI.

The eno genes were amplified from chromosomal DNA using forward and reverse primers incorporating a BamHI or SalI restriction site, respectively (primer 1: GCG GAT CCA TGT CAA TTA TTA CTG ATG TTT ACG, primer 2: GCT GTC GAC TTA TTA TTT TTT AAG GTT GTA GAA TGA TTT).

BTN1 was amplified from plasmid pAA1793 using forward and reverse primers engineered with a SalI tag (italics) on both (forward: 5′- GTCGACATGAGTGACAAATCTCAT-3′; reverse: 5′- GTC-GACTTCCATCCTACACCAAAG-3′).

PpGT47A was PCR amplified from Physcomitrella DNA using forward primer (F): 5′-ggggacaagtttgtacaaaaaagcaggctgggagaattgggtgtttcg-3′ and reverse primer (R): 5′-ggggaccactttgtacaagaaagctgggtgtgttacaaatcattgcccc-3′), cloned into pDONR207 and then transferred into the pEarleyGate 100 destination vector [ 50] using the Gateway cloning system.