Your English writing platform
Discover LudwigSuggestions(4)
Exact(3)
In August, Freeze confirmed that the siblings were suffering from the same condition as Bertrand.
"Please don't let my daughter die, Governor," Brian Wilson, the father of a 2-year-old girl who suffers from Dravet Syndrome, a severe form of epilepsy, said to Christie at a diner in Scotch Plains, N.J. "Don't let my daughter die". As CNN reported last year, a non-psychoactive form of marijuana was used to help treat a 6-year-old suffering from the same condition as Wilson's daughter.
Participants were also asked to make suggestions as to what questions could be included in a QoL questionnaire suitable for others who suffer from the same condition as them.
Similar(57)
At site E, patients reported receiving information and support from peers with the same condition, as well as from their church minister.
In our case control study, we used proxy informants for controls who were recruited from hospitals under the same condition as the sCJD case-patients.
Without kinase exposure, FRET from PAGE4 A18C increased from 0.56 to 0.72 upon exposure to full length c-Jun, while FRET from PAGE4 P102C decreased from 0.69 to 0.37 in the same condition as we had observed previously.
When an artist has made a sculpture out of butter, or scalpels, or half a passenger jet, it is up to a shipper to get it from Hong Kong to Miami in the same condition as when it left, and to make no fuss.
The "cold" chars were then employed for the ex-situ gasification in 15% steam atmosphere at 900°C for 10 min. For comparison, the in-situ gasification of "hot" char derived from pyrolysis without quenching was conducted by changing the reaction atmosphere from argon to 15% steam (under the same condition as the ex-situ gasification).
The F2 population, consisting of 141 individuals (from 144 seeds), was grown from June to November 2003 under the same conditions as the BC1 F1, used for DNA extraction to construct a molecular linkage map and evaluated for domestication-related traits (Table 1).
We therefore analyzed total lipids isolated from cells under the same conditions as the samples used for LC-MS, allowing a direct comparison between the identities of the lipid mixtures and their properties.
Primers (panD_F: 5'TCandGGTTCCGGTCGGCTGCT3' and panD_R: 5'TATCCGCCACTGCTGCACGACCTT3') were used to amplify a 650 bp PCR product that contains the whole panD gene from PZA-resistant M. tuberculosis strains using the same condition as above for amplifying the pncA gene.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com