Your English writing platform
Discover LudwigExact(60)
Using these databases, anybody can consult and benefit from the retrieved information.
The left image is the historical photo chosen from the retrieved collection.
Although ComBase contains a vast amount of data, it is not easy to obtain desired information from the retrieved data.
The method is evaluated objectively against a gold standard segmentation and transcription, as well as subjectively through building and testing speech synthesis systems from the retrieved data.
First, this study reviews taphonomic pathways of plant remains to clarify how far we can draw cultural implications from the retrieved remains.
Some data were extracted from the retrieved data as seen in Table 2.
Given an initial tweet, we select the top 10 relevant conversations from the retrieved collection, as relevant.
From the retrieved "Natural Disaster in India" data from Twitter Sentiment Analysis has shown the opinion of the people.
Black lines denote the observed spectra, and red lines denote the spectra calculated from the retrieved O3 profile.
From the retrieved two DNA sequences, a new primer set (F: AAGTATTAGATCGTTACGGCGATGGAC, R: CCAAGAACACCAATCGTGTTATCAAGG) was designed and once again sent to Eurofins Genomics together with genomic DNA.
Tracking multiple objects and keeping record of their identities along time in a cluttered dynamic scene is a major research topic in computer vision, basically fostered by the number of applications that benefit from the retrieved information.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com