Your English writing platform
Discover LudwigExact(9)
The data obtained from chimeras are more convincing.
And even then, polycistronic transcripts which may exist cannot be separated from chimeras perfectly [ 53].
Given that chimeric mRNAs share sequences with their precursor genes, determining which reads come from chimeras is necessary.
All the consensus TE sequences were manually reviewed and curated from chimeras, duplicates, and nested elements to build the TE reference library of M. oryzae.
Male chimeras were bred with Actb-Cre females to delete the PGK-Neo cassette, and germ-line transmission of the wild-type Tex11 knockin allele was obtained from chimeras derived from both ES cell clones.
In order to reduce complexity and separate naturally occurring multi-gene transcripts from chimeras induced by assembly errors, cleaned read pairs that concordantly mapped to R. communis organellar genomes were removed using Bowtie 2 v. 2.0.0-beta7 2.0.0-beta7
Similar(51)
The template DNAs were from chimera TcTIM1 4 and from TbTIM for the first and second PCR reactions, respectively.
The external T7 promoter oligonucleotide and the sequence 5'GCGTTCTGTGCGGCAATCTG3' (Rv12) were used to amplify regions 1 and 2 of TcTIM using DNA from chimera TcTIM 1 4 as a template.
The DNA of TbTIM was taken as a template with the T7 promoter and sequence Rv1 to amplify region 1 from TbTIM and join it to regions 2 8 from chimera TcTIM 1 3, 5 8 amplified with the T7 terminator and sequence Fw28 using the DNA of this same chimera as a template.
They used skin and bone marrow cells from chimera mice developed from iPSCs.
Eight to twelve weeks later, ear skin and skin-draining lymph nodes were obtained from chimera.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com