Your English writing platform
Discover LudwigExact(6)
Instead, they have to work from a template of appropriations supplied by the governor, in the form of his annual executive budget.
These days, when mass mailings often carry a presidential scrawl fashioned by a machine from a template of the original, the notion of a bond between a person and his signed name, as between a person and his word, is becoming as quaint as the tale of George Washington and the cherry tree.
Novel peptide antifungals engineered from a template of mammalian, amphibian and even insect endogenous antimicrobial peptides (AMPs) have clear potential to meet these requirements and consequent clinical success in a range of fungal diseases.
This mechanism is associated with extensive nucleotide sequence identity between the two parental genomes around the cross-over site and copy choice or template switching during the replication process, that involves detachment from a template of the polymerase complex with a nascent product, and continuation of the copying process at the same position of another template molecule.
The word 'intelligence' is often misused, largely because of the ease with which patterns of plant behavior can be extrapolated from a template of animal or human behavior (anthropomorphism).
Common 5′assembly primer 5′ER01 (5′-CACC ATGAAAACTAATCTTTTCTTGTTTCTTATCTTTTCACTTCTTTTGAGCTTAAGCTCTGCAG-3′) and 3′ assembly primer 3′ER20 (5′- TTACAACTCGTCATGCTTGTACAGCTCGTCCATGCCG-3′) were used in conjunction with sequence specific assembly primers in assembly PCR from a template of fluorescent protein coding sequence described above.
Similar(54)
Twenty years on from these twin eruptions, South Africa remains a template of reconciliation studied everywhere from Northern Ireland to Palestine, but the Rwandan genocide can be seen as a fork in the road not just for Africa but the world.
You might even get a template of one from a friend who has already gone through divorce.
The full length cDNA of Mef2cbS was obtained by a PCR reaction starting from a template made of three overlapping PCR products: the exon 5 region amplified from a Mef2cb I.M.A.G.E.
Anatase TiO2 nanostructure arrays were synthetized starting from a template made of self-standing ZnO NWs prepared by an electrodeposition technique.
Past instructors created a PowerPoint from a rudimentary template of each chapter provided by the textbook publisher, and they stood in front of the students reading from these PowerPoints.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com