Sentence examples for frequently identified from inspiring English sources

Exact(60)

The previously reported uncultured Prevotella clone PUS9.180 was frequently identified.

p53 gene mutations are frequently identified in ovarian cancer tissue.

Vasopressin and oxytocin are frequently identified as neuropeptides related to aggressive behaviors.

Staphylococcal species were most frequently identified, 42% of which were methicillin-resistant Staphylococcus aureus (MRSA).

The sequence CGGGAGGGGGGGTCCTGGAGGC (termed HCV110-131) was the most frequently identified and occurred 65 times among the 106 sequences.

Deregulation of this pathway has been frequently identified in the development of hepatocellular carcinoma (HCC).

Additionally, the present study provides further confirmation of a frequently identified QTL on chromosome 1.

Several chromosomal aberrations have been frequently identified in melanomas, but are absent in melanocytic naevi.

Macrophages are frequently identified in solid tumors, playing important roles in cancer progression.

Cervical pain was the most frequently identified condition for which the activator was used.

De-novo dominant mutations are frequently identified; somatic mosaicism and recessive disorders are also seen.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: