Sentence examples for frequently identified from inspiring English sources

The previously reported uncultured Prevotella clone PUS9.180 was frequently identified.

p53 gene mutations are frequently identified in ovarian cancer tissue.

Vasopressin and oxytocin are frequently identified as neuropeptides related to aggressive behaviors.

Staphylococcal species were most frequently identified, 42% of which were methicillin-resistant Staphylococcus aureus (MRSA).

The sequence CGGGAGGGGGGGTCCTGGAGGC (termed HCV110-131) was the most frequently identified and occurred 65 times among the 106 sequences.

Deregulation of this pathway has been frequently identified in the development of hepatocellular carcinoma (HCC).

Additionally, the present study provides further confirmation of a frequently identified QTL on chromosome 1.

Several chromosomal aberrations have been frequently identified in melanomas, but are absent in melanocytic naevi.

Macrophages are frequently identified in solid tumors, playing important roles in cancer progression.

Cervical pain was the most frequently identified condition for which the activator was used.

De-novo dominant mutations are frequently identified; somatic mosaicism and recessive disorders are also seen.