Some main factors considered in selecting readers and tags are operating frequency, read performance, ruggedness, compliance with standards, operating conditions, and ability to upgrade.
Most clinical machines now offer the capability to create ADC maps by averaging three diffusion-weighted images which have encoded diffusion in the slice, frequency (read) and phase-encode directions respectively.
EF (attentional control, action control, short-term memory (STM)) and home factors (reading frequency, reading climate, parent education) were measured in kindergarten.
Research on voice analysis has been undertaken regarding various vocal features, such as the pitch, frequency, reading speed, shimmer, harmonics, formants, and energy of the voice, using computerized speech laboratory methods [ 18- 20].
To ensure that these low-frequency read pairs supporting the recombinant conformation are not due to cross-contamination, we mapped the raw reads from all three species to three variable regions in the genomes (supplementary fig. S2, Supplementary Material online).
Variant frequencies, read coverage and gene annotation information are shown simultaneously at various scales.
This application allows users to see variant frequencies, read depth and annotation information in a scalable and smooth manner.
As shown in Fig. 3, IME-EF4 and IME-EFm1 HTS read data have two significant high-frequency reads, beginning with CTTTCGCTTAAACGAATCTC and ATTAGTTTCTTCAAAAAATT, respectively.
Finally, a stable frequency reading in buffer is reached at −33 Hz.
Carlisle and Stone (2005) found that derived words that were phonologically transparent and high frequency were read more accurately and faster than phonological shift and low-frequency words for children.
Even the most dedicated book lover becomes a learner reader, having to decide in which order and with what frequency to read the paragraphs and margins.
