Your English writing platform
Discover LudwigExact(1)
A second reverse primer was designed from the cloned sequence up to and including the stop codon from the open reading frame (reverse 5′ AGAAAGCTGGGTGTTAGTTCCGGTACCAAAAAACACCTTTGGT 3′).
Similar(59)
"We are moving toward very dramatic changes over an extremely rapid time frame, reversing a planetary cooling trend in a matter of centuries".
For confirmation of norovirus and strain genotyping, samples were further assayed by open reading frame 1 reverse transcription PCR (RT-PCR) by using biotin-labeled JV12 ad JV13 primers and reverse line blot hybridization (RLBH) (12 ).
Shariatmadar and Beydokhti (2014) tested three full scale precast beam to column connections by considering different detailing i.e., straight spliced, U-shaped spliced and U-shape spliced with steel plates within connection zone which was part of five-storey frame under reverse cyclic loading and compared its performance with monolithic connections.
Previous reports have generated a drug-resistant virus by introducing a Shanghai1 NA segment with a 292K mutation into a Anhui1 gene frame using reverse genetics.
Using the Frame 3 reverse translation of comp103_c0_seq1, BLASTP and TBLASTX searches both suggested that the best match is a PLA2 gene cluster from P. flavoviridis (in Frame 1) [ 70].
CaMV: Cauliflower mosaic virus; GFP: Green fluorescent protein; ER: Endoplasmic reticulum; ORF: Opening reading frame; RT: Reverse transcripts; TM: Transmembrane; ZIP: Zinc-regulated transporters, iron-regulated transporter-like protein.
CGD: Candida Genome Database; CGOB: Candida Gene Order Browser; FPKM: fragments per kilobase of transcript per million fragments mapped; GO: Gene Ontology; ncRNA: non-coding RNA; nTAR: novel transcriptional active region; ORF: open reading frame; RT: reverse transcription; snRNA: small nuclear RNA; UTR: untranslated region.
mRNA-derived retrocopies provide raw material for the evolution of genes in a wide variety of ways, duplicating and amending the protein coding region of existing genes as well as generating the potential for new protein coding space, or non-protein coding RNAs, by unexpected contributions out of frame, in reverse orientation, or from previously non-protein coding sequence.
Playing the frames in reverse order left the form information (the configuration of dots) unaltered.
The phrasing of the scale items is balanced between positive and negative perspectives: 11 of the 22 items in the final scale are negatively framed, requiring reverse scoring.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com