Your English writing platform
Discover LudwigSimilar(60)
All in vitro experiments were at least four times repeated.
The transverse impact load was applied in single and three times repeated form.
But they are all one self, one God, as it were three times repeated or multiplied.
"The president of the country three times repeated there will be no discrimination".
All the samples were processed two times repeating above procedure.
Results were confirmed by at least three times repeats.
Repeat 4 two times, and repeat 6 two times.
As an example, an HcRed1-coding region was amplified from pHcRed1 (Clontech) by PCR using primers containing four-time repeated Tag(gau) sequences and XhoI, SalI, and EcoRI restriction sites (forward, 5'-AAAAAGCAGGCTTCGAAGGAGATAGAACCATGGTGAGCGGCC-3'; reverse, 5'-AGAAAGCTGGGTGAATTCAGAGGTCGACCTTATTCTCAATCCAATCCTTATTCTCAATCCAATCCTTATTCTCAATCCAATCCTTATTCTCAATCCAATCCTCGAGTCAGTTGGCCTTCTCGGG-3').
The same health staff made the all four-time repeated visits for each participant to minimize between-interviewer variation.
The assays were repeated four times.
All the measurements were repeated four times.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com