Sentence examples for forward used for from inspiring English sources

Non-responder imputation was used for the analysis of all categorical response measures, and last observation carried forward used for continuous endpoints.

The primary analysis was modified intent-to-treat, which included all randomised subjects who received at least one blinded dose of test article, with the last observation carried forward used for missing values.

A double power function is put forward using for transitional curve, which is continuous and smooth at all connection points independent of its parameters, so the sudden change of mechanical parameters during rolling and forming process can be avoided.

From the source to the sink, multi-hop forwarding is used for data forwarding.

Also, the part of the forward HCAL used for the luminosity measurement is instrumented with new readout electronics, in microTCA standards.

RESULTS: An intention-to-treat principle (last value forward) was used for data analyses that tested the primary and secondary hypotheses.

Finally, the patent describes the forward elevator, used for ascending and descending.

CTGCAACTACTGAAATCTGCCA (forward) was used for sequencing.

The last observation carried forward was used for missing data.

Last observation carried forward was used for imputing missing data.

Last observation carried forward was used for missing data in the ITT analysis.