Your English writing platform
Discover LudwigExact(1)
We've already heard an exert from one of the song's off new album R Plus Seven from Oneohtrix Point Never (aka Daniel Lopatin), and now he's unveiled the first full track "Problem Areas"—an "unrelenting, machine-mitigated drive forward, marked by continuous ostinato bass that goes off the rails toward an oblique segue".
Similar(59)
REBOUNDS The Nets placed the rookie center EVAN ESCHMEYER on the injured list with a severely sprained left ankle and signed forward MARK HENDRICKSON to a 10-day contract.
REBOUNDS The Knicks signed three free agents to fill out their training camp roster: forward MARK POPE and guards TOBY BAILEY and DANNY JOHNSON.... JERRY HICKS, KURT THOMAS's agent and lawyer, said that once Thomas arrived in Charleston, "he'll make sure his teammates and coaches know" that his arrest would not be a distraction.
Rangers again failed to take off-field positivity on to the park as 17-year-old Queen of the South forward Aidan Smith marked his first league appearance with a late equaliser in a 1-1 drat at Ibrox.
But when about 100 Latino congregants, overcoming fears about their safety and in some cases their immigration status, came forward, it marked the turning point in what became a major case of racial profiling, in which four East Haven police officers were arrested last week on federal charges of conspiracy, false arrest, excessive force and obstruction of justice.
Huddersfield's England forward Brett Ferres marked his 200th Super League appearance by touching down Brough's kick for a try and the game really opened up in the final quarter, with Wheeler hacking on a loose ball to grab his second try and Cudjoe pouncing on a handling error at the other end to enable Blackmore to double his match tally.
They responded after the break when substitute forward Kevin Larroyer marked his 100th match by powering over the line, and Mantellato converted.
Primers used in the qPCR with the forward primer marked with 6-carboxyfluorescein (FAM) (Additional file 1: Table S1) were used for the T-RFLP (Ying et al. 2010).
We designed a forward primer (marked in yellow) in this region and were able to amplify a product utilizing a reverse primer in exon 25 (5′ CAGCGCATCGTCAAAGAGATG3′, spanning intron 24, 255 bp).
The forward-forward matches are marked with red lines, and the forward-reverse matches are marked with blue lines.
Vince Lia would then step forward to mark Matt McKay.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com